-
Notifications
You must be signed in to change notification settings - Fork 1k
add nirvana #9633
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
Open
FriederikeHanssen
wants to merge
15
commits into
nf-core:master
Choose a base branch
from
FriederikeHanssen:nirvana
base: master
Could not load branches
Branch not found: {{ refName }}
Loading
Could not load tags
Nothing to show
Loading
Are you sure you want to change the base?
Some commits from the old base branch may be removed from the timeline,
and old review comments may become outdated.
Open
add nirvana #9633
Changes from all commits
Commits
Show all changes
15 commits
Select commit
Hold shift + click to select a range
ad2d2e4
add nirvana
FriederikeHanssen 72dbc40
adsnapshots
FriederikeHanssen 0247f65
Merge branch 'master' into nirvana
FriederikeHanssen ade1a99
use content due to timestamp in file
FriederikeHanssen 9a0c833
Merge remote-tracking branch 'origin/nirvana' into nirvana
FriederikeHanssen a58237d
test with only using the docker container
FriederikeHanssen e61dc58
test oras protocol. somehow dotnet is missing in the singularity cont…
FriederikeHanssen 1af4b0f
use amd oras image
FriederikeHanssen 2b25a5c
Update modules/nf-core/nirvana/main.nf
FriederikeHanssen bbaff86
test with symlink before pushing upstream
FriederikeHanssen daf8950
Merge remote-tracking branch 'origin/nirvana' into nirvana
FriederikeHanssen 8e012af
Merge branch 'master' into nirvana
FriederikeHanssen d8b4bec
test new container
FriederikeHanssen 2636961
merge upstream
FriederikeHanssen 4ff25f7
remove symlinking shouldn't be necessary anymore
FriederikeHanssen File filter
Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
There are no files selected for viewing
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,7 @@ | ||
| --- | ||
| # yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json | ||
| channels: | ||
| - conda-forge | ||
| - bioconda | ||
| dependencies: | ||
| - bioconda::nirvana=3.18.1 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,43 @@ | ||
| process NIRVANA { | ||
| tag "${meta.id}" | ||
| label 'process_medium' | ||
|
|
||
| conda "${moduleDir}/environment.yml" | ||
| container 'community.wave.seqera.io/library/nirvana:3.18.1--51c5bd56fef22808' | ||
|
|
||
| input: | ||
| tuple val(meta) , path(vcf) | ||
| tuple val(meta2), path(reference) | ||
| tuple val(meta3), path(cache), val(cache_prefix) | ||
| tuple val(meta4), path(supplementary_annotations) | ||
|
|
||
| output: | ||
| tuple val(meta), path("*.json.gz"), emit: json | ||
| tuple val(meta), path("*.json.gz.jsi"), emit: jsi | ||
| tuple val("${task.process}"), val('nirvana'), eval("Nirvana -v 2>&1 | awk '{print \$2}' | cut -d'-' -f1"), topic: versions, emit: versions_nirvana | ||
|
|
||
| when: | ||
| task.ext.when == null || task.ext.when | ||
|
|
||
| script: | ||
| def args = task.ext.args ?: '' | ||
| def prefix = task.ext.prefix ?: "${meta.id}" | ||
| def cache_command = cache ? "-c ${cache}/${cache_prefix}" : "" | ||
| def sa_command = supplementary_annotations ? "--sd ${supplementary_annotations}" : "" | ||
| """ | ||
| Nirvana \\ | ||
| -i ${vcf} \\ | ||
| -r ${reference} \\ | ||
| ${cache_command} \\ | ||
| ${sa_command} \\ | ||
| ${args} \\ | ||
| -o ${prefix} | ||
| """ | ||
|
|
||
| stub: | ||
| def prefix = task.ext.prefix ?: "${meta.id}" | ||
| """ | ||
| echo "" | gzip > ${prefix}.json.gz | ||
| touch ${prefix}.json.gz.jsi | ||
| """ | ||
| } | ||
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,109 @@ | ||
| # yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json | ||
| name: "nirvana" | ||
| description: Clinical-grade annotation of genomic variants including SNVs, MNVs, insertions, deletions, indels, and SVs | ||
| keywords: | ||
| - annotation | ||
| - variant annotation | ||
| - vcf | ||
| - genomics | ||
| - clinical annotation | ||
| tools: | ||
| - "nirvana": | ||
| description: "Clinical-grade annotation of genomic variants (SNVs, MNVs, insertions, | ||
| deletions, indels, and SVs)" | ||
| homepage: "https://illumina.github.io/NirvanaDocumentation/" | ||
| documentation: "https://illumina.github.io/NirvanaDocumentation/" | ||
| tool_dev_url: "https://github.com/Illumina/Nirvana" | ||
| licence: ["GPL v3"] | ||
| identifier: biotools:nirvana | ||
|
|
||
| input: | ||
| - - meta: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing sample information | ||
| e.g. `[ id:'sample1' ]` | ||
| - vcf: | ||
| type: file | ||
| description: Input VCF file to annotate | ||
| pattern: "*.{vcf,vcf.gz}" | ||
| ontologies: | ||
| - edam: "http://edamontology.org/format_3016" # VCF | ||
| - - meta2: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing reference information | ||
| e.g. `[ id:'genome' ]` | ||
| - reference: | ||
| type: file | ||
| description: Compressed Nirvana reference sequence file | ||
| pattern: "*.dat" | ||
| - - meta3: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing cache information | ||
| e.g. `[ id:'cache' ]` | ||
| - cache: | ||
| type: directory | ||
| description: Nirvana cache directory | ||
| - cache_prefix: | ||
| type: string | ||
| description: Prefix for cache files (e.g., 'SARS-CoV-2' for files like SARS-CoV-2.transcripts.ndb) | ||
| - - meta4: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing supplementary annotation information | ||
| e.g. `[ id:'sa' ]` | ||
| - supplementary_annotations: | ||
| type: directory | ||
| description: Nirvana supplementary annotation directory (optional) | ||
|
|
||
| output: | ||
| json: | ||
| - - meta: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing sample information | ||
| e.g. `[ id:'sample1' ]` | ||
| - "*.json.gz": | ||
| type: file | ||
| description: Gzip-compressed JSON file with variant annotations | ||
| pattern: "*.json.gz" | ||
| ontologies: | ||
| - edam: "http://edamontology.org/format_3464" # JSON | ||
| jsi: | ||
| - - meta: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing sample information | ||
| e.g. `[ id:'sample1' ]` | ||
| - "*.json.gz.jsi": | ||
| type: file | ||
| description: JSON index file for the annotations | ||
| pattern: "*.json.gz.jsi" | ||
| versions_nirvana: | ||
| - - "${task.process}": | ||
| type: string | ||
| description: The name of the process | ||
| - "nirvana": | ||
| type: string | ||
| description: The name of the tool | ||
| - "Nirvana -v 2>&1 | awk '{print $2}' | cut -d'-' -f1": | ||
| type: eval | ||
| description: The expression to obtain the version of the tool | ||
|
|
||
| topics: | ||
| versions: | ||
| - - ${task.process}: | ||
| type: string | ||
| description: The name of the process | ||
| - nirvana: | ||
| type: string | ||
| description: The name of the tool | ||
| - "Nirvana -v 2>&1 | awk '{print $2}' | cut -d'-' -f1": | ||
| type: eval | ||
| description: The expression to obtain the version of the tool | ||
| authors: | ||
| - "@FriederikeHanssen" | ||
| maintainers: | ||
| - "@FriederikeHanssen" |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,108 @@ | ||
| nextflow_process { | ||
|
|
||
| name "Test Process NIRVANA" | ||
| script "../main.nf" | ||
| process "NIRVANA" | ||
|
|
||
| tag "modules" | ||
| tag "modules_nfcore" | ||
| tag "nirvana" | ||
| tag "untar" | ||
|
|
||
| setup { | ||
| run("UNTAR", alias: "UNTAR_CACHE") { | ||
| script "../../untar/main.nf" | ||
| process { | ||
| """ | ||
| input[0] = [ | ||
| [ id:'Cache' ], | ||
| file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/nirvana/Cache.tar', checkIfExists: true) | ||
| ] | ||
| """ | ||
| } | ||
| } | ||
|
|
||
| run("UNTAR", alias: "UNTAR_SA") { | ||
| script "../../untar/main.nf" | ||
| process { | ||
| """ | ||
| input[0] = [ | ||
| [ id:'SupplementaryAnnotation' ], | ||
| file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/nirvana/SupplementaryAnnotation.tar', checkIfExists: true) | ||
| ] | ||
| """ | ||
| } | ||
| } | ||
| } | ||
|
|
||
| test("sarscov2 - vcf") { | ||
|
|
||
| when { | ||
| process { | ||
| """ | ||
| input[0] = [ | ||
| [ id:'test' ], | ||
| file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true) | ||
| ] | ||
| input[1] = [ | ||
| [ id:'reference' ], | ||
| file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/nirvana/SARS-CoV-2.ASM985889v3.dat', checkIfExists: true) | ||
| ] | ||
| input[2] = UNTAR_CACHE.out.untar.map { meta, dir -> | ||
| [ meta, dir, 'SARS-CoV-2' ] | ||
| } | ||
| input[3] = UNTAR_SA.out.untar | ||
| """ | ||
| } | ||
| } | ||
|
|
||
| then { | ||
| assertAll( | ||
| { assert process.success }, | ||
| // Remove creationTime field from JSON and snapshot the rest | ||
| { assert snapshot( | ||
| path(process.out.json[0][1]).linesGzip.collect { | ||
| it.replaceAll(/"creationTime":"[^"]*",?/, '') | ||
| } | ||
| ).match("json_content") }, | ||
| // Just check JSI exists | ||
| { assert path(process.out.jsi[0][1]).exists() }, | ||
| { assert snapshot(process.out.versions_nirvana).match() } | ||
| ) | ||
| } | ||
|
|
||
| } | ||
|
|
||
| test("sarscov2 - vcf - stub") { | ||
|
|
||
| options "-stub" | ||
|
|
||
| when { | ||
| process { | ||
| """ | ||
| input[0] = [ | ||
| [ id:'test' ], | ||
| file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/vcf/test.vcf.gz', checkIfExists: true) | ||
| ] | ||
| input[1] = [ | ||
| [ id:'reference' ], | ||
| file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/nirvana/SARS-CoV-2.ASM985889v3.dat', checkIfExists: true) | ||
| ] | ||
| input[2] = UNTAR_CACHE.out.untar.map { meta, dir -> | ||
| [ meta, dir, 'SARS-CoV-2' ] | ||
| } | ||
| input[3] = UNTAR_SA.out.untar | ||
| """ | ||
| } | ||
| } | ||
|
|
||
| then { | ||
| assertAll( | ||
| { assert process.success }, | ||
| { assert snapshot(process.out).match() } | ||
| ) | ||
| } | ||
|
|
||
| } | ||
|
|
||
| } |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,97 @@ | ||
| { | ||
| "json_content": { | ||
| "content": [ | ||
| [ | ||
| "{\"header\":{\"annotator\":\"Nirvana 3.18.1\",\"genomeAssembly\":\"SARSCoV2\",\"schemaVersion\":6,\"dataVersion\":\"0.27.66\",\"dataSources\":[{\"name\":\"RefSeq\",\"version\":\"NC_045512.2\",\"description\":\"Severe acute respiratory syndrome coronavirus 2 (SARS-CoV2)\",\"releaseDate\":\"2020-03-20\"},{\"name\":\"alleleFrequency\",\"version\":\"SARS-COV-2_AllFreq.tsv\",\"releaseDate\":\"2020-05-08\"},{\"name\":\"proteinDomains\",\"version\":\"SARS-CoV-2_ProteinDomains.tsv\",\"releaseDate\":\"2020-05-08\"},{\"name\":\"MitochondrialHeteroplasmy\",\"version\":\"20180410\",\"description\":\"Variant read frequency percentiles for the Mitochondrial reference\",\"releaseDate\":\"2020-05-21\"}],\"samples\":[\"test\"]},\"positions\":[", | ||
| "{\"chromosome\":\"MT192765.1\",\"position\":197,\"refAllele\":\"G\",\"altAlleles\":[\"T\"],\"quality\":7.3081,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-197-G-T\",\"chromosome\":\"MT192765.1\",\"begin\":197,\"end\":197,\"refAllele\":\"G\",\"altAllele\":\"T\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.197G>T\"}]},", | ||
| "{\"chromosome\":\"MT192765.1\",\"position\":4788,\"refAllele\":\"C\",\"altAlleles\":[\"T\"],\"quality\":7.3081,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-4788-C-T\",\"chromosome\":\"MT192765.1\",\"begin\":4788,\"end\":4788,\"refAllele\":\"C\",\"altAllele\":\"T\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.4788C>T\"}]},", | ||
| "{\"chromosome\":\"MT192765.1\",\"position\":8236,\"refAllele\":\"C\",\"altAlleles\":[\"A\"],\"quality\":7.3081,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-8236-C-A\",\"chromosome\":\"MT192765.1\",\"begin\":8236,\"end\":8236,\"refAllele\":\"C\",\"altAllele\":\"A\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.8236C>A\"}]},", | ||
| "{\"chromosome\":\"MT192765.1\",\"position\":10506,\"refAllele\":\"TTATGACTGTGTCTCTTTTTGTTACATGCACCATATG\",\"altAlleles\":[\"TTATG\"],\"quality\":18.4617,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"0/1\"}],\"variants\":[{\"vid\":\"MT192765.1-10510-NACTGTGTCTCTTTTTGTTACATGCACCATATG-N\",\"chromosome\":\"MT192765.1\",\"begin\":10511,\"end\":10542,\"refAllele\":\"ACTGTGTCTCTTTTTGTTACATGCACCATATG\",\"altAllele\":\"-\",\"variantType\":\"deletion\",\"hgvsg\":\"MT192765.1:g.10511_10542del\"}]},", | ||
| "{\"chromosome\":\"MT192765.1\",\"position\":11037,\"refAllele\":\"T\",\"altAlleles\":[\"C\"],\"quality\":7.3081,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-11037-T-C\",\"chromosome\":\"MT192765.1\",\"begin\":11037,\"end\":11037,\"refAllele\":\"T\",\"altAllele\":\"C\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.11037T>C\"}]},", | ||
| "{\"chromosome\":\"MT192765.1\",\"position\":15009,\"refAllele\":\"G\",\"altAlleles\":[\"A\"],\"quality\":30.4183,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-15009-G-A\",\"chromosome\":\"MT192765.1\",\"begin\":15009,\"end\":15009,\"refAllele\":\"G\",\"altAllele\":\"A\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.15009G>A\"}]},", | ||
| "{\"chromosome\":\"MT192765.1\",\"position\":18807,\"refAllele\":\"T\",\"altAlleles\":[\"C\"],\"quality\":136,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-18807-T-C\",\"chromosome\":\"MT192765.1\",\"begin\":18807,\"end\":18807,\"refAllele\":\"T\",\"altAllele\":\"C\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.18807T>C\"}]},", | ||
| "{\"chromosome\":\"MT192765.1\",\"position\":23813,\"refAllele\":\"T\",\"altAlleles\":[\"C\"],\"quality\":4.3847,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-23813-T-C\",\"chromosome\":\"MT192765.1\",\"begin\":23813,\"end\":23813,\"refAllele\":\"T\",\"altAllele\":\"C\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.23813T>C\"}]},", | ||
| "{\"chromosome\":\"MT192765.1\",\"position\":24103,\"refAllele\":\"A\",\"altAlleles\":[\"G\"],\"quality\":30.4183,\"filters\":[\"LowQual\"],\"mappingQuality\":60,\"samples\":[{\"genotype\":\"1/1\"}],\"variants\":[{\"vid\":\"MT192765.1-24103-A-G\",\"chromosome\":\"MT192765.1\",\"begin\":24103,\"end\":24103,\"refAllele\":\"A\",\"altAllele\":\"G\",\"variantType\":\"SNV\",\"hgvsg\":\"MT192765.1:g.24103A>G\"}]}", | ||
| "]}" | ||
| ] | ||
| ], | ||
| "meta": { | ||
| "nf-test": "0.9.3", | ||
| "nextflow": "25.10.2" | ||
| }, | ||
| "timestamp": "2026-01-12T09:27:01.830246" | ||
| }, | ||
| "sarscov2 - vcf": { | ||
| "content": [ | ||
| [ | ||
| [ | ||
| "NIRVANA", | ||
| "nirvana", | ||
| "Nirvana 3.18.1" | ||
| ] | ||
| ] | ||
| ], | ||
| "meta": { | ||
| "nf-test": "0.9.3", | ||
| "nextflow": "25.10.2" | ||
| }, | ||
| "timestamp": "2026-01-12T09:27:01.842455" | ||
| }, | ||
| "sarscov2 - vcf - stub": { | ||
| "content": [ | ||
| { | ||
| "0": [ | ||
| [ | ||
| { | ||
| "id": "test" | ||
| }, | ||
| "test.json.gz:md5,68b329da9893e34099c7d8ad5cb9c940" | ||
| ] | ||
| ], | ||
| "1": [ | ||
| [ | ||
| { | ||
| "id": "test" | ||
| }, | ||
| "test.json.gz.jsi:md5,d41d8cd98f00b204e9800998ecf8427e" | ||
| ] | ||
| ], | ||
| "2": [ | ||
| [ | ||
| "NIRVANA", | ||
| "nirvana", | ||
| "Nirvana 3.18.1" | ||
| ] | ||
| ], | ||
| "jsi": [ | ||
| [ | ||
| { | ||
| "id": "test" | ||
| }, | ||
| "test.json.gz.jsi:md5,d41d8cd98f00b204e9800998ecf8427e" | ||
| ] | ||
| ], | ||
| "json": [ | ||
| [ | ||
| { | ||
| "id": "test" | ||
| }, | ||
| "test.json.gz:md5,68b329da9893e34099c7d8ad5cb9c940" | ||
| ] | ||
| ], | ||
| "versions_nirvana": [ | ||
| [ | ||
| "NIRVANA", | ||
| "nirvana", | ||
| "Nirvana 3.18.1" | ||
| ] | ||
| ] | ||
| } | ||
| ], | ||
| "meta": { | ||
| "nf-test": "0.9.3", | ||
| "nextflow": "25.10.2" | ||
| }, | ||
| "timestamp": "2026-01-12T09:27:21.144398" | ||
| } | ||
| } |
Oops, something went wrong.
Add this suggestion to a batch that can be applied as a single commit.
This suggestion is invalid because no changes were made to the code.
Suggestions cannot be applied while the pull request is closed.
Suggestions cannot be applied while viewing a subset of changes.
Only one suggestion per line can be applied in a batch.
Add this suggestion to a batch that can be applied as a single commit.
Applying suggestions on deleted lines is not supported.
You must change the existing code in this line in order to create a valid suggestion.
Outdated suggestions cannot be applied.
This suggestion has been applied or marked resolved.
Suggestions cannot be applied from pending reviews.
Suggestions cannot be applied on multi-line comments.
Suggestions cannot be applied while the pull request is queued to merge.
Suggestion cannot be applied right now. Please check back later.
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
Is the cache_prefix a path or a specific string within the path?
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
If the data looks like this:
then the
cacheis./Cache/SARS-CoV-2/and thecache_prefixisSARS-CoV-2(here the one that is the prefix of the filename), so it overall is resolved to./Cache/SARS-CoV-2/SARS-CoV-2.I am not certain we can enforce people to match the prefix on the actual files with the folder name. I have not seen more Nirvana caches to check how this normally looks like. Alternatively, we could possible stage in the files and somehow extract the cache prefix to build the path, but it feels brittle
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
I think we should do this at the workflow level, so I'm fine with this.