chore: Remove extraneous files, fix small issues in README

.gitignore

@@ -1,6 +1,11 @@
 */*.o
+src/.nfs*
+.DS_STORE
 src/contrafold
 src/api_test
+src/make_coords
+src/plot_rna
+src/score_prediction
 src/optimize.*
 input_data/*
 old_input_data/*

README.md

@@ -4,7 +4,7 @@ An EternaFold server is available at [eternafold.eternagame.org](https://eternaf
 
 EternaFold performs multitask learning to improve RNA structure prediction. Its training tasks include 1) predicting single structures, 2) maximizing the likelihood of structure probing data, and 3) predicting experimentally-measured affinities of RNA molecules to proteins and small molecules.
 
-Its training data comes from diverse high-throughput experimental crowdsourced data from the [Eterna](www.eternagame.org) project.
+Its training data comes from diverse high-throughput experimental crowdsourced data from the [Eterna](https://www.eternagame.org) project.
 
 EternaFold is possible thanks to [CONTRAfold-SE](https://github.com/csfoo/contrafold-se) (C.-S. Foo, C. Pop).
 
@@ -32,7 +32,9 @@ See instructions in [README_LinearFold-E_patch.md](README_LinearFold-E_patch.md)
 #### Single-structure prediction
 Predict the MEA structure of example test sequence (Hammerhead ribozyme), using the EternaFold parameters:
 
-`./src/contrafold predict test.seq --params parameters/EternaFoldParams.v1`
+```bash
+./src/contrafold predict test.seq --params parameters/EternaFoldParams.v1
+```
 
 Output:
 ```
@@ -51,7 +53,7 @@ CGCUGUCUGUACUUGUAUCAGUACACUGACGAGUCCCUAAAGGACGAAACAGCG
 Predict the maximum-likelihood structure of the given sequence, using SHAPE likelihood potentials learned from Cloud Lab SHAPE MAP-seq experiments (Wayment-Steele et. al, 2022).
 
 Predicted structure of example construct without incorporating SHAPE data:
-```
+```bash
 ./src/contrafold predict test_SHAPE.seq --params parameters/EternaFoldParams.v1
 ```
 Output:
@@ -68,7 +70,7 @@ UGUACCGGAAGGUGCGAAUCUUCCG
 
 Alternate structure is predicted upon incorporating SHAPE data in `test_SHAPE.bpseq`:
 
-```
+```bash
 ./src/contrafold predict test_SHAPE.bpseq --evidence --numdatasources 1 --kappa 0.1 --params parameters/EternaFoldParams_PLUS_POTENTIALS.v1 
 ```
 
@@ -88,8 +90,8 @@ UGUACCGGAAGGUGCGAAUCUUCCG
 
 #### Ensemble free energy prediction
 
-```
-$ ./src/contrafold predict test.seq --params parameters/EternaFoldParams.v1 --partition
+```bash
+./src/contrafold predict test.seq --params parameters/EternaFoldParams.v1 --partition
 ```
 
 Output (log partition coefficient)
@@ -101,7 +103,7 @@ Log partition coefficient for "test.seq": 13.7489
 ```
 #### Base-pairing probability prediction
 
-```
+```bash
 ./src/contrafold predict test.seq --params parameters/EternaFoldParams.v1 --posteriors 0.00001 bps.txt
 ```
 
@@ -124,7 +126,7 @@ Base-pairing probabilities are output to `bps.txt`:
 #### Sample structures
 
 Stochastically samples structures from the underlying distribution. 
-```
+```bash
 ./src/contrafold sample test.seq --params parameters/EternaFoldParams.v1 --nsamples 10
 ```
 
@@ -147,7 +149,7 @@ Use evidence: 0
 
 `sample` can be used in conjunction with SHAPE data to sample SHAPE-reweighted distribution:
 
-```
+```bash
 ./src/contrafold sample test_SHAPE.bpseq --params parameters/EternaFoldParams_PLUS_POTENTIALS.v1 --nsamples 10 --evidence --numdatasources 1 --kappa 0.1
 ```
 
@@ -185,19 +187,25 @@ From CONTRAfold-SE:
 
 Assumes that folder "trainset" has a set of sequences of type ".bpseq" in evidence format for the ones with data.
 
-`contrafold train --regularize 1 --numdatasources 2 --maxiter 1000 --hyperparam_data 0.1 --initweights contrafold.params.complementary_data2 trainset/*.bpseq`
+```bash
+contrafold train --regularize 1 --numdatasources 2 --maxiter 1000 --hyperparam_data 0.1 --initweights contrafold.params.complementary_data2 trainset/*.bpseq
+```
 
 If there are a large number of input files used (> 1000 files; e.g. for training on RMDB data), provide a text file containing the list of example files instead with the `--examplefile` option.
 
-`contrafold train --regularize 1 --numdatasources 1 --maxiter 500 --examplefile examples.txt`"
+```bash
+contrafold train --regularize 1 --numdatasources 1 --maxiter 500 --examplefile examples.txt
+```
 
 #### Training options for riboswitch data
 
-`contrafold train --examplefile ../production_struct_riboswitches.txt --regularize 32  --kd_hyperparam_data 30 --ligand --ligand_bonus 90 --lig_hyperparam_data 30`
+```bash
+contrafold train --examplefile ../production_struct_riboswitches.txt --regularize 32  --kd_hyperparam_data 30 --ligand --ligand_bonus 90 --lig_hyperparam_data 30
+```
 
-`kd_hyperparam_data`: weight placed on no-ligand kd values.
-`lig_hyperparam_data`: weight placed on ligand kd values.
-`ligand_bonus`: ligand bonus used.
+- `kd_hyperparam_data`: weight placed on no-ligand kd values.
+- `lig_hyperparam_data`: weight placed on ligand kd values.
+- `ligand_bonus`: ligand bonus used.
 
 
 ### Input file formats
@@ -240,18 +248,20 @@ k1.0 2.0 99
 
 This code has been modified in two ways that means its output, even using the CONTRAfold parameters, will differ from the CONTRAfold codebase here and the CONTRAfold-SE codebase here.
 
-1. A bug was fixed in the multiloop traceback `InferenceEngine.ipp` which was first identified by He Zhang (Oregon State). 
+1. A bug was fixed in the multiloop traceback [`InferenceEngine.ipp`](src/InferenceEngine.ipp) which was first identified by He Zhang (Oregon State). 
 
-2. The minimum allowable hairpin size was increased from `0` to `3` to prevent structure predictions with `(())` hairpins. To revert back to the original CONTRAfold behavior, set `C_MIN_HP_LENGTH=0` in `Config.hpp` before compiling.
+2. The minimum allowable hairpin size was increased from `0` to `3` to prevent structure predictions with `(())` hairpins. To revert back to the original CONTRAfold behavior, set `C_MIN_HAIRPIN_LENGTH=0` in `Config.hpp` before compiling.
 
 Predictions for Hammerhead Ribozyme sequence, using default CONTRAfold parameters: `CGCUGUCUGUACUUGUAUCAGUACACUGACGAGUCCCUAAAGGACGAAACAGCG`
 
+```bash
 contrafold predict hhr.bpseq --partition 
+```
 
 | Version | hhr.bpseq Log Partition Coefficient |
 | --- | ----------- |
 |CONTRAfold v2.02| 6.87394|
 |CONTRAfold-SE| 6.87394|
-|EternaFold code, no ML fix and C_MIN_HP_LENGTH=0| 6.87394|
-|EternaFold code, C_MIN_HP_LENGTH=0| 6.83585|
+|EternaFold code, no ML fix and C_MIN_HAIRPIN_LENGTH=0| 6.87394|
+|EternaFold code, C_MIN_HAIRPIN_LENGTH=0| 6.83585|
 |EternaFold code | 6.77285 |