[DRAFT] Evo 2 SAE feature explorer — visualization mockup

bionemo-recipes/interpretability/sparse_autoencoders/recipes/evo2/README.md

@@ -0,0 +1,30 @@
+# Evo2 SAE Recipe
+
+Train a sparse autoencoder on Evo2 (DNA language model) residual-stream activations.
+
+Pipeline:
+
+```
+HF Savanna ckpt --convert--> MBridge ckpt
+                              |
+                      predict_evo2 --embedding-layer N (FASTA in, .pt out)
+                              |
+                      pt_to_parquet shim (.pt -> ActivationStore parquet shards)
+                              |
+                      train.py (TopK SAE)
+```
+
+The eval / dashboard stage from the esm2 recipe is intentionally not ported in v1.
+
+## Quick start (1B model, single GPU)
+
+```bash
+bash scripts/1b.sh
+```
+
+This will:
+
+1. Convert `arcinstitute/savanna_evo2_1b_base` to MBridge format
+2. Run `predict_evo2` on the OpenGenome2 organelle FASTA, extracting layer-12 embeddings
+3. Convert the .pt outputs to parquet shards
+4. Train a TopK SAE (expansion=8, k=32)

bionemo-recipes/interpretability/sparse_autoencoders/recipes/evo2/evo2_dashboard_mockup/.gitignore

@@ -0,0 +1,4 @@
+node_modules/
+package-lock.json
+dist/
+.vite/

bionemo-recipes/interpretability/sparse_autoencoders/recipes/evo2/evo2_dashboard_mockup/README.md

@@ -0,0 +1,55 @@
+# Evo 2 SAE Feature Explorer — Mockup
+
+**Mockup, not a real artifact.** This is a fork of `recipes/codonfm/codon_dashboard` adapted for DNA / Evo 2, populated with **synthetic data**. No real SAE outputs flow through it yet. The point of this v1 is to lock in the data contract that the future real eval pipeline will target.
+
+A `MOCKUP — synthetic data, not from a real SAE run` banner is rendered at the top of the app so nobody mistakes it for actual results.
+
+## Quick start (local)
+
+```bash
+# In this directory:
+npm install
+npm run dev
+# open http://localhost:5173
+```
+
+The dashboard reads three parquet fixtures from `public/`:
+
+- `features_atlas.parquet` — UMAP coordinates + per-feature aggregates
+- `feature_metadata.parquet` — feature label/stats table
+- `feature_examples.parquet` — long table of (feature_id, example_rank, sequence_id, start, end, sequence, activations, ...) rows
+
+The fixtures are committed to the repo. To regenerate them:
+
+```bash
+python ../scripts/make_mockup_features.py
+```
+
+That writes all three files into `public/`. Seed is fixed (`--seed 42`).
+
+## What's mocked vs. real
+
+| Thing                                | Source                                                          |
+| ------------------------------------ | --------------------------------------------------------------- |
+| Number of features                   | 20, hardcoded                                                   |
+| Feature labels                       | Hardcoded biological-sounding strings                           |
+| UMAP coordinates                     | 4 cluster centers + gaussian noise — fake but visibly clustered |
+| Top activator windows                | Random `ACGT` with a label-matching central motif spliced in    |
+| Per-token activations                | Gaussian bump centered randomly in [80, 120], sigma ~= 8 bp     |
+| Vocab logits (promoted / suppressed) | Empty arrays — not in scope for v1                              |
+
+## v2 roadmap placeholders
+
+A few greyed-out stats on each feature card (`Annotation`, `Sensitivity`, `Recon Δ`) and two empty sections on the feature detail page (`Annotations`, `Conservation`) hint at what's coming in v2. They render as em-dashes / dashed empty boxes with hover tooltips explaining what they'll show.
+
+## Out of scope (v1)
+
+- Real SAE inference or activation pass
+- Annotation overlays (RefSeq / Rfam / JASPAR)
+- Conservation tracks (phyloP)
+- Strand handling, codon framing, chromosome ideograms
+- External link-outs (UCSC, Ensembl)
+- `sae.launch_dashboard()` Python wiring — run `npm run dev` directly
+- Lepton-based serving
+
+These are deferred to v2, once the real eval pipeline produces matching parquet shapes.

bionemo-recipes/interpretability/sparse_autoencoders/recipes/evo2/evo2_dashboard_mockup/index.html

@@ -0,0 +1,104 @@
+<!DOCTYPE html>
+<html lang="en">
+  <head>
+    <meta charset="UTF-8" />
+    <meta name="viewport" content="width=device-width, initial-scale=1.0" />
+    <title>Evo 2 SAE Feature Explorer (Mockup)</title>
+    <style>
+      @font-face {
+        font-family: 'NVIDIA Sans';
+        font-style: normal;
+        src: url(https://brand-assets.cne.ngc.nvidia.com/assets/fonts/nvidia-sans/1.0.0/NVIDIASans_Lt.woff2);
+        font-weight: light;
+      }
+      @font-face {
+        font-family: 'NVIDIA Sans';
+        font-style: italic;
+        src: url(https://brand-assets.cne.ngc.nvidia.com/assets/fonts/nvidia-sans/1.0.0/NVIDIASans_LtIt.woff2);
+        font-weight: light;
+      }
+      @font-face {
+        font-family: 'NVIDIA Sans';
+        font-style: normal;
+        src: url(https://brand-assets.cne.ngc.nvidia.com/assets/fonts/nvidia-sans/1.0.0/NVIDIASans_Rg.woff2);
+        font-weight: normal;
+      }
+      @font-face {
+        font-family: 'NVIDIA Sans';
+        font-style: italic;
+        src: url(https://brand-assets.cne.ngc.nvidia.com/assets/fonts/nvidia-sans/1.0.0/NVIDIASans_It.woff2);
+        font-weight: normal;
+      }
+      @font-face {
+        font-family: 'NVIDIA Sans';
+        font-style: normal;
+        src: url(https://brand-assets.cne.ngc.nvidia.com/assets/fonts/nvidia-sans/1.0.0/NVIDIASans_Bd.woff2);
+        font-weight: bold;
+      }
+      @font-face {
+        font-family: 'NVIDIA Sans';
+        font-style: italic;
+        src: url(https://brand-assets.cne.ngc.nvidia.com/assets/fonts/nvidia-sans/1.0.0/NVIDIASans_BdIt.woff2);
+        font-weight: bold;
+      }
+      :root {
+        --bg: #f5f5f5;
+        --bg-card: #fff;
+        --bg-card-expanded: #fafafa;
+        --bg-example: #fff;
+        --bg-input: #fff;
+        --border: #e0e0e0;
+        --border-light: #eee;
+        --border-input: #ddd;
+        --text: #333;
+        --text-secondary: #666;
+        --text-tertiary: #888;
+        --text-muted: #999;
+        --text-heading: #000;
+        --accent: #76b900;
+        --highlight-border: #222;
+        --highlight-shadow: rgba(0,0,0,0.15);
+        --link: #2563eb;
+        --loading-bar-bg: #e0e0e0;
+        --density-bar-bg: #e0e0e0;
+        --scrollbar-thumb: #ccc;
+      }
+      :root.dark {
+        --bg: #000;
+        --bg-card: #000;
+        --bg-card-expanded: #000;
+        --bg-example: #0a0a0a;
+        --bg-input: #0a0a0a;
+        --border: #444;
+        --border-light: #3a3a3a;
+        --border-input: #4a4a4a;
+        --text: #E0E0E0;
+        --text-secondary: #bbb;
+        --text-tertiary: #999;
+        --text-muted: #777;
+        --text-heading: #fff;
+        --accent: #76b900;
+        --highlight-border: #76b900;
+        --highlight-shadow: rgba(118,185,0,0.3);
+        --link: #76b900;
+        --loading-bar-bg: #444;
+        --density-bar-bg: #444;
+        --scrollbar-thumb: #555;
+      }
+      * {
+        margin: 0;
+        padding: 0;
+        box-sizing: border-box;
+      }
+      body {
+        font-family: 'NVIDIA Sans', -apple-system, BlinkMacSystemFont, 'Segoe UI', Roboto, sans-serif;
+        background: var(--bg);
+        color: var(--text);
+      }
+    </style>
+  </head>
+  <body>
+    <div id="root"></div>
+    <script type="module" src="/src/index.jsx"></script>
+  </body>
+</html>

bionemo-recipes/interpretability/sparse_autoencoders/recipes/evo2/evo2_dashboard_mockup/package.json

@@ -0,0 +1,25 @@
+{
+  "name": "evo2-dashboard-mockup",
+  "version": "0.1.0",
+  "private": true,
+  "type": "module",
+  "scripts": {
+    "dev": "vite",
+    "build": "vite build",
+    "preview": "vite preview"
+  },
+  "dependencies": {
+    "@uwdata/mosaic-core": "^0.21.1",
+    "@uwdata/mosaic-sql": "^0.21.1",
+    "@uwdata/vgplot": "^0.21.1",
+    "embedding-atlas": "^0.16.1",
+    "lucide-react": "^0.577.0",
+    "react": "^18.2.0",
+    "react-dom": "^18.2.0",
+    "umap-js": "^1.4.0"
+  },
+  "devDependencies": {
+    "@vitejs/plugin-react": "^4.2.0",
+    "vite": "^5.0.0"
+  }
+}

bionemo-recipes/interpretability/sparse_autoencoders/recipes/evo2/evo2_dashboard_mockup/public/steering_data.json

@@ -0,0 +1,146 @@
+{
+  "seeds": {
+    "ecoli_16s": {
+      "name": "E. coli 16S rRNA region (A1408 example)",
+      "sequence": "ATCCGTCAACCTTCAAGCATCCAAACGGCGATGATCAAGGCATAAGCCTACAGGGTACCATAGCGAAGCTGCGTCTGAAGCGAACTGGCAAACGGCTAACAGCG",
+      "length": 100,
+      "alphabet": "DNA",
+      "default_target_position": 8,
+      "context_note": "Position 8 in this synthetic sequence is the analog of position 1408 in the full 16S rRNA. Sequence shown as DNA bases to match Evo2 tokenization."
+    },
+    "promoter": {
+      "name": "Promoter region",
+      "sequence": "ATCGATGCGTAGCATGCATGGCATATATAAGCATCGATCGATCGATGCATGCTAGCATGCTAGCATGCATGCAT",
+      "length": 73,
+      "alphabet": "DNA",
+      "default_target_position": 24,
+      "context_note": "Non-rRNA context. AMR features should not shift predictions here."
+    },
+    "brca1_exon": {
+      "name": "BRCA1 exon fragment",
+      "sequence": "ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGTCTGGAGTTGAT",
+      "length": 90,
+      "alphabet": "DNA",
+      "default_target_position": 45,
+      "context_note": "Human exonic context. AMR features (bacterial rRNA) should have no effect here."
+    },
+    "random": {
+      "name": "Random control sequence",
+      "sequence": "GACTGCATCGATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC",
+      "length": 73,
+      "alphabet": "DNA",
+      "default_target_position": 30,
+      "context_note": "No biological structure; serves as a negative control for AMR steering."
+    }
+  },
+  "features_available": [
+    {"id": 12, "label": "kanamycin_resistance", "is_amr": true},
+    {"id": 13, "label": "streptomycin_resistance", "is_amr": true}
+  ],
+  "comparisons": {
+    "ecoli_16s__kanamycin_resistance__pos8": {
+      "seed": "ecoli_16s",
+      "feature_id": 12,
+      "target_position": 8,
+      "neighbor_count": 1,
+      "results_by_clamp": {
+        "-2": {"baseline": {"A": 0.74, "C": 0.12, "G": 0.08, "T": 0.06}, "steered": {"A": 0.91, "C": 0.04, "G": 0.03, "T": 0.02}},
+        "0":  {"baseline": {"A": 0.74, "C": 0.12, "G": 0.08, "T": 0.06}, "steered": {"A": 0.74, "C": 0.12, "G": 0.08, "T": 0.06}},
+        "2":  {"baseline": {"A": 0.74, "C": 0.12, "G": 0.08, "T": 0.06}, "steered": {"A": 0.42, "C": 0.08, "G": 0.43, "T": 0.07}},
+        "5":  {"baseline": {"A": 0.74, "C": 0.12, "G": 0.08, "T": 0.06}, "steered": {"A": 0.18, "C": 0.07, "G": 0.71, "T": 0.04}}
+      },
+      "narrative_type": "headline_amr"
+    },
+    "ecoli_16s__streptomycin_resistance__pos8": {
+      "seed": "ecoli_16s",
+      "feature_id": 13,
+      "target_position": 8,
+      "neighbor_count": 1,
+      "results_by_clamp": {
+        "-2": {"baseline": {"A": 0.74, "C": 0.12, "G": 0.08, "T": 0.06}, "steered": {"A": 0.88, "C": 0.05, "G": 0.04, "T": 0.03}},
+        "0":  {"baseline": {"A": 0.74, "C": 0.12, "G": 0.08, "T": 0.06}, "steered": {"A": 0.74, "C": 0.12, "G": 0.08, "T": 0.06}},
+        "2":  {"baseline": {"A": 0.74, "C": 0.12, "G": 0.08, "T": 0.06}, "steered": {"A": 0.50, "C": 0.09, "G": 0.34, "T": 0.07}},
+        "5":  {"baseline": {"A": 0.74, "C": 0.12, "G": 0.08, "T": 0.06}, "steered": {"A": 0.26, "C": 0.08, "G": 0.62, "T": 0.04}}
+      },
+      "narrative_type": "headline_amr"
+    },
+    "promoter__kanamycin_resistance__pos24": {
+      "seed": "promoter",
+      "feature_id": 12,
+      "target_position": 24,
+      "neighbor_count": 1,
+      "results_by_clamp": {
+        "-2": {"baseline": {"A": 0.62, "C": 0.10, "G": 0.08, "T": 0.20}, "steered": {"A": 0.63, "C": 0.10, "G": 0.08, "T": 0.19}},
+        "0":  {"baseline": {"A": 0.62, "C": 0.10, "G": 0.08, "T": 0.20}, "steered": {"A": 0.62, "C": 0.10, "G": 0.08, "T": 0.20}},
+        "2":  {"baseline": {"A": 0.62, "C": 0.10, "G": 0.08, "T": 0.20}, "steered": {"A": 0.59, "C": 0.11, "G": 0.10, "T": 0.20}},
+        "5":  {"baseline": {"A": 0.62, "C": 0.10, "G": 0.08, "T": 0.20}, "steered": {"A": 0.55, "C": 0.12, "G": 0.13, "T": 0.20}}
+      },
+      "narrative_type": "null_result"
+    },
+    "promoter__streptomycin_resistance__pos24": {
+      "seed": "promoter",
+      "feature_id": 13,
+      "target_position": 24,
+      "neighbor_count": 1,
+      "results_by_clamp": {
+        "-2": {"baseline": {"A": 0.62, "C": 0.10, "G": 0.08, "T": 0.20}, "steered": {"A": 0.63, "C": 0.10, "G": 0.08, "T": 0.19}},
+        "0":  {"baseline": {"A": 0.62, "C": 0.10, "G": 0.08, "T": 0.20}, "steered": {"A": 0.62, "C": 0.10, "G": 0.08, "T": 0.20}},
+        "2":  {"baseline": {"A": 0.62, "C": 0.10, "G": 0.08, "T": 0.20}, "steered": {"A": 0.60, "C": 0.10, "G": 0.10, "T": 0.20}},
+        "5":  {"baseline": {"A": 0.62, "C": 0.10, "G": 0.08, "T": 0.20}, "steered": {"A": 0.57, "C": 0.11, "G": 0.12, "T": 0.20}}
+      },
+      "narrative_type": "null_result"
+    },
+    "brca1_exon__kanamycin_resistance__pos45": {
+      "seed": "brca1_exon",
+      "feature_id": 12,
+      "target_position": 45,
+      "neighbor_count": 1,
+      "results_by_clamp": {
+        "-2": {"baseline": {"A": 0.31, "C": 0.21, "G": 0.28, "T": 0.20}, "steered": {"A": 0.31, "C": 0.21, "G": 0.28, "T": 0.20}},
+        "0":  {"baseline": {"A": 0.31, "C": 0.21, "G": 0.28, "T": 0.20}, "steered": {"A": 0.31, "C": 0.21, "G": 0.28, "T": 0.20}},
+        "2":  {"baseline": {"A": 0.31, "C": 0.21, "G": 0.28, "T": 0.20}, "steered": {"A": 0.30, "C": 0.21, "G": 0.29, "T": 0.20}},
+        "5":  {"baseline": {"A": 0.31, "C": 0.21, "G": 0.28, "T": 0.20}, "steered": {"A": 0.28, "C": 0.21, "G": 0.31, "T": 0.20}}
+      },
+      "narrative_type": "null_result"
+    },
+    "brca1_exon__streptomycin_resistance__pos45": {
+      "seed": "brca1_exon",
+      "feature_id": 13,
+      "target_position": 45,
+      "neighbor_count": 1,
+      "results_by_clamp": {
+        "-2": {"baseline": {"A": 0.31, "C": 0.21, "G": 0.28, "T": 0.20}, "steered": {"A": 0.31, "C": 0.21, "G": 0.28, "T": 0.20}},
+        "0":  {"baseline": {"A": 0.31, "C": 0.21, "G": 0.28, "T": 0.20}, "steered": {"A": 0.31, "C": 0.21, "G": 0.28, "T": 0.20}},
+        "2":  {"baseline": {"A": 0.31, "C": 0.21, "G": 0.28, "T": 0.20}, "steered": {"A": 0.30, "C": 0.22, "G": 0.28, "T": 0.20}},
+        "5":  {"baseline": {"A": 0.31, "C": 0.21, "G": 0.28, "T": 0.20}, "steered": {"A": 0.29, "C": 0.22, "G": 0.29, "T": 0.20}}
+      },
+      "narrative_type": "null_result"
+    },
+    "random__kanamycin_resistance__pos30": {
+      "seed": "random",
+      "feature_id": 12,
+      "target_position": 30,
+      "neighbor_count": 1,
+      "results_by_clamp": {
+        "-2": {"baseline": {"A": 0.28, "C": 0.22, "G": 0.27, "T": 0.23}, "steered": {"A": 0.27, "C": 0.23, "G": 0.27, "T": 0.23}},
+        "0":  {"baseline": {"A": 0.28, "C": 0.22, "G": 0.27, "T": 0.23}, "steered": {"A": 0.28, "C": 0.22, "G": 0.27, "T": 0.23}},
+        "2":  {"baseline": {"A": 0.28, "C": 0.22, "G": 0.27, "T": 0.23}, "steered": {"A": 0.26, "C": 0.24, "G": 0.28, "T": 0.22}},
+        "5":  {"baseline": {"A": 0.28, "C": 0.22, "G": 0.27, "T": 0.23}, "steered": {"A": 0.25, "C": 0.25, "G": 0.29, "T": 0.21}}
+      },
+      "narrative_type": "null_result"
+    },
+    "random__streptomycin_resistance__pos30": {
+      "seed": "random",
+      "feature_id": 13,
+      "target_position": 30,
+      "neighbor_count": 1,
+      "results_by_clamp": {
+        "-2": {"baseline": {"A": 0.28, "C": 0.22, "G": 0.27, "T": 0.23}, "steered": {"A": 0.28, "C": 0.22, "G": 0.27, "T": 0.23}},
+        "0":  {"baseline": {"A": 0.28, "C": 0.22, "G": 0.27, "T": 0.23}, "steered": {"A": 0.28, "C": 0.22, "G": 0.27, "T": 0.23}},
+        "2":  {"baseline": {"A": 0.28, "C": 0.22, "G": 0.27, "T": 0.23}, "steered": {"A": 0.27, "C": 0.23, "G": 0.28, "T": 0.22}},
+        "5":  {"baseline": {"A": 0.28, "C": 0.22, "G": 0.27, "T": 0.23}, "steered": {"A": 0.26, "C": 0.24, "G": 0.29, "T": 0.21}}
+      },
+      "narrative_type": "null_result"
+    }
+  }
+}