add anvi-gen-contigs-database module

modules/nf-core/anvio/anvi-gen-contigs-database/environment.yml

@@ -0,0 +1,7 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
+channels:
+  - conda-forge
+  - bioconda
+dependencies:
+  - bioconda::anvio-minimal=9

modules/nf-core/anvio/anvi-gen-contigs-database/main.nf

@@ -0,0 +1,39 @@
+process ANVIO_ANVI_GEN_CONTIGS_DATABASE {
+    tag "$meta.id"
+    label 'process_medium'
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/anvio-minimal:9--pyhdfd78af_0':
+        'quay.io/biocontainers/anvio-minimal:9--pyhdfd78af_0' }"
+
+    input:
+    tuple val(meta), path(fasta), path(external_gene_calls)
+
+    output:
+    tuple val(meta), path("*.CONTIGS.db"), emit: contigs_db
+    tuple val("${task.process}"), val('anvio'), eval("anvi-gen-contigs-database --version 2>&1 | head -n 1 | cut -f 2 -d : | cut -c 2- | sed 's/.*(v//; s/).*//'"), emit: versions_anvio, topic: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def external_gene_calls_arg = external_gene_calls ? "--external-gene-calls ${external_gene_calls}" : ''
+    """
+    anvi-gen-contigs-database \\
+        $args \\
+        --num-threads $task.cpus \\
+        --contigs-fasta $fasta \\
+        --project-name "$prefix" \\
+        --output-db-path ${prefix}.CONTIGS.db \\
+        $external_gene_calls_arg
+    """
+
+    stub:
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    """
+    touch ${prefix}.CONTIGS.db
+    """
+}

modules/nf-core/anvio/anvi-gen-contigs-database/meta.yml

@@ -0,0 +1,77 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json
+name: "anvio_anvi_gen_contigs_database"
+description: Generate an anvi'o contigs database from FASTA sequences.
+keywords:
+  - anvio
+  - contigs
+  - database
+  - metagenomics
+  - fasta
+tools:
+  - "anvio":
+      description: "Anvi'o is an analysis and visualization platform for 'omics data."
+      homepage: "https://merenlab.org/software/anvio/"
+      documentation: "https://anvio.org/help/9/programs/anvi-gen-contigs-database/"
+      tool_dev_url: "https://github.com/merenlab/anvio"
+      doi: "10.1038/s41564-020-00834-3"
+      licence:
+        - "GPL-3.0-or-later"
+      identifier: biotools:anvio
+input:
+  - - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information
+          e.g. `[ id:'sample1', single_end:false ]`
+    - fasta:
+        type: file
+        description: FASTA file containing contigs or genome sequences.
+        pattern: "*.{fa,fasta,fna,fa.gz,fasta.gz,fna.gz}"
+        ontologies:
+          - edam: http://edamontology.org/format_1929 # FASTA
+    - external_gene_calls:
+        type: file
+        optional: true
+        description: Optional TAB-delimited external gene calls file for anvi'o.
+        pattern: "*.{txt,tsv}"
+        ontologies:
+          - edam: http://edamontology.org/format_3475 # TSV
+output:
+  contigs_db:
+    - - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information
+            e.g. `[ id:'sample1', single_end:false ]`
+      - "*.CONTIGS.db":
+          type: file
+          description: Anvi'o contigs database.
+          pattern: "*.CONTIGS.db"
+          ontologies:
+            - edam: http://edamontology.org/format_3621 # SQLite format
+  versions_anvio:
+    - - "${task.process}":
+          type: string
+          description: The name of the process
+      - anvio:
+          type: string
+          description: The name of the tool
+      - "anvi-gen-contigs-database --version 2>&1 | head -n 1 | cut -f 2 -d : | cut -c 2- | sed 's/.*(v//; s/).*//'":
+          type: eval
+          description: The expression to obtain the version of the tool
+topics:
+  versions:
+    - - "${task.process}":
+          type: string
+          description: The name of the process
+      - anvio:
+          type: string
+          description: The name of the tool
+      - "anvi-gen-contigs-database --version 2>&1 | head -n 1 | cut -f 2 -d : | cut -c 2- | sed 's/.*(v//; s/).*//'":
+          type: eval
+          description: The expression to obtain the version of the tool
+authors:
+  - "@telatin"
+maintainers:
+  - "@telatin"

modules/nf-core/anvio/anvi-gen-contigs-database/tests/main.nf.test

@@ -0,0 +1,67 @@
+nextflow_process {
+
+    name "Test Process ANVIO_ANVI_GEN_CONTIGS_DATABASE"
+    script "../main.nf"
+    process "ANVIO_ANVI_GEN_CONTIGS_DATABASE"
+    config "./nextflow.config"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "anvio"
+    tag "anvio/anvi-gen-contigs-database"
+
+    test("anvi-gen-contigs-database - synthetic fasta") {
+
+        when {
+            process {
+                """
+                input[0] = Channel.of(
+                    ">contig_1",
+                    "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT",
+                    "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT",
+                    ">contig_2",
+                    "TTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGC",
+                    "TTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGC"
+                )
+                .collectFile(name: "contigs.fa", newLine: true, sort: false)
+                .map { fasta -> [ [ id:'test' ], fasta, [] ] }
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert process.out.contigs_db.size() == 1 },
+                { assert file(process.out.contigs_db[0][1]).name == "test.CONTIGS.db" },
+                { assert file(process.out.contigs_db[0][1]).length() > 0 },
+                { assert snapshot(process.out.versions_anvio).match("versions") }
+            )
+        }
+    }
+
+    test("anvi-gen-contigs-database - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = Channel.of(
+                    ">contig_1",
+                    "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT"
+                )
+                .collectFile(name: "contigs.fa", newLine: true, sort: false)
+                .map { fasta -> [ [ id:'test' ], fasta, [] ] }
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
+}

modules/nf-core/anvio/anvi-gen-contigs-database/tests/main.nf.test.snap

@@ -0,0 +1,59 @@
+{
+    "versions": {
+        "content": [
+            [
+                [
+                    "ANVIO_ANVI_GEN_CONTIGS_DATABASE",
+                    "anvio",
+                    "9"
+                ]
+            ]
+        ],
+        "timestamp": "2026-05-20T10:37:17.429792",
+        "meta": {
+            "nf-test": "0.9.4",
+            "nextflow": "25.10.4"
+        }
+    },
+    "anvi-gen-contigs-database - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.CONTIGS.db:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    [
+                        "ANVIO_ANVI_GEN_CONTIGS_DATABASE",
+                        "anvio",
+                        "9"
+                    ]
+                ],
+                "contigs_db": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.CONTIGS.db:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions_anvio": [
+                    [
+                        "ANVIO_ANVI_GEN_CONTIGS_DATABASE",
+                        "anvio",
+                        "9"
+                    ]
+                ]
+            }
+        ],
+        "timestamp": "2026-05-20T10:37:28.314211",
+        "meta": {
+            "nf-test": "0.9.4",
+            "nextflow": "25.10.4"
+        }
+    }
+}

modules/nf-core/anvio/anvi-gen-contigs-database/tests/nextflow.config

@@ -0,0 +1,5 @@
+process {
+    withName: 'ANVIO_ANVI_GEN_CONTIGS_DATABASE' {
+        ext.args = '--skip-gene-calling'
+    }
+}